Stem-loop sequence hsa-mir-598

AccessionMI0003610 (change log)
Symbol HGNC:MIR598
DescriptionHomo sapiens miR-598 stem-loop
Gene family MIPF0000393; mir-598
Literature search

14 open access papers mention hsa-mir-598
(27 sentences)

Stem-loop
   gcuugaugaugcugcugaugcu         cc     gu  g   uggaa 
5'                       ggcggugau  cgaug  gu agc     a
                         |||||||||  |||||  || |||      
3'                       cugcuacug  gcuac  ca ucg     u
   ------gagccuacuacuacua         uu     ug  -   ugggg 
Get sequence
Deep sequencing
214505 reads, 138 reads per million, 144 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 11035206-11035302 [-]
sense
OTTHUMT00000383958 ; XKR6-002; intron 1
OTTHUMT00000383959 ; XKR6-004; intron 1
ENST00000416569 ; XKR6-002; intron 1
ENST00000529336 ; XKR6-004; intron 1
Database links

Mature sequence hsa-miR-598-5p

Accession MIMAT0026620
Sequence

24 - 

gcggugaucccgauggugugagc

 - 46

Get sequence
Deep sequencing150 reads, 31 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence hsa-miR-598-3p

Accession MIMAT0003266
Sequence

61 - 

uacgucaucguugucaucguca

 - 82

Get sequence
Deep sequencing214225 reads, 143 experiments
Evidence experimental; Microarray [1], SAGE [1], cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).