Stem-loop sequence hsa-mir-597

AccessionMI0003609 (change log)
Symbol HGNC:MIR597
DescriptionHomo sapiens miR-597 stem-loop
Gene family MIPF0000479; mir-597
Literature search

4 open access papers mention hsa-mir-597
(8 sentences)

Stem-loop
   u   --          -----g  u     uc  u         gaag   gu 
5'  acu  uacucuacgu      ug gucac  ga gaccacugu    aca  a
    |||  ||||||||||      || |||||  || |||||||||    |||   
3'  ugg  augagaugua      ac cggug  cu uuggugaca    ugu  a
   c   uc          augcga  u     uu  c         ----   aa 
Get sequence
Deep sequencing
636 reads, 0 reads per million, 97 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 9741672-9741768 [+]
intergenic
Database links

Mature sequence hsa-miR-597-5p

Accession MIMAT0003265
Sequence

16 - 

ugugucacucgaugaccacugu

 - 37

Get sequence
Deep sequencing316 reads, 62 experiments
Evidence experimental; SAGE [1], cloned [2], Illumina [3]
Predicted targets

Mature sequence hsa-miR-597-3p

Accession MIMAT0026619
Sequence

58 - 

ugguucucuuguggcucaagcgu

 - 80

Get sequence
Deep sequencing314 reads, 83 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).