Stem-loop sequence hsa-mir-595

AccessionMI0003607 (change log)
Symbol HGNC:MIR595
DescriptionHomo sapiens miR-595 stem-loop
Gene family MIPF0000651; mir-595
Literature search

11 open access papers mention hsa-mir-595
(18 sentences)

Stem-loop
   -ac  --aag   g  c  auuua      --       -    g ag   u 
5'    gg     ccu ca gc     acacca  gcacgcu caau u  ucu g
      ||     ||| || ||     ||||||  ||||||| |||| |  ||| u
3'    cc     gga gu ug     uguggu  cguguga guug a  agg a
   ugu  gcgaa   g  c  -----      gc       a    g ca   a 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 158532718-158532813 [-]
sense
OTTHUMT00000322651 ; ESYT2-005; intron 2
OTTHUMT00000322647 ; ESYT2-001; intron 17
OTTHUMT00000322650 ; ESYT2-004; intron 18
ENST00000435514 ; ESYT2-005; intron 2
ENST00000251527 ; ESYT2-001; intron 17
ENST00000275418 ; ESYT2-004; intron 18
Database links

Mature sequence hsa-miR-595

Accession MIMAT0003263
Sequence

61 - 

gaagugugccguggugugucu

 - 81

Get sequence
Evidence experimental; RT-PCR [1], SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).