Stem-loop sequence hsa-mir-593

AccessionMI0003605 (change log)
Symbol HGNC:MIR593
DescriptionHomo sapiens miR-593 stem-loop
Gene family MIPF0000503; mir-593
Literature search

12 open access papers mention hsa-mir-593
(63 sentences)

Stem-loop
   -------c      aaucugu    c  c    a     ug   agccc       u 
5'         ccccag       cagg ac agcc ggcau  cuc     guuuccc c
           ||||||       |||| || |||| |||||  |||     |||||||  
3'         gggguc       gucu ug uugg ucgug  gag     cgagggg u
   uccucuuu      -------    c  u    g     gu   --gaa       g 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 128081861-128081960 [+]
intergenic
Database links

Mature sequence hsa-miR-593-5p

Accession MIMAT0003261
Previous IDshsa-miR-593;hsa-miR-593*
Sequence

16 - 

aggcaccagccaggcauugcucagc

 - 40

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SAGE [1]
Predicted targets

Mature sequence hsa-miR-593-3p

Accession MIMAT0004802
Previous IDshsa-miR-593
Sequence

79 - 

ugucucugcugggguuucu

 - 97

Get sequence
Deep sequencing10 reads, 9 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).