Stem-loop sequence hsa-mir-592

AccessionMI0003604 (change log)
Symbol HGNC:MIR592
DescriptionHomo sapiens miR-592 stem-loop
Gene family MIPF0000340; mir-592
Literature search

14 open access papers mention hsa-mir-592
(139 sentences)

Stem-loop
   ---------ua     c     ca        a    c        gu    a 
5'            uuaug cauga  uuguguca uaug gaugaugu  ugug u
              ||||| |||||  |||||||| |||| ||||||||  ||||  
3'            aaugc guacu  aacgcagu gugc cuacugcg  acac g
   caacacugcag     a     ac        g    a        --    g 
Get sequence
Deep sequencing
1351 reads, 0 reads per million, 109 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 127058088-127058184 [-]
sense
OTTHUMT00000268491 ; ZNF800-008; intron 1
ENST00000439506 ; ZNF800-008; intron 1
Database links

Mature sequence hsa-miR-592

Accession MIMAT0003260
Sequence

16 - 

uugugucaauaugcgaugaugu

 - 37

Get sequence
Deep sequencing1264 reads, 109 experiments
Evidence experimental; Microarray [1], RT-PCR [1], SAGE [1]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).