Stem-loop sequence hsa-mir-590

AccessionMI0003602 (change log)
Symbol HGNC:MIR590
DescriptionHomo sapiens miR-590 stem-loop
Gene family MIPF0000418; mir-590
Literature search

68 open access papers mention hsa-mir-590
(407 sentences)

Stem-loop
   --------uagc        a  g       u       g     ua   u 
5'             cagucaga au agcuuau cauaaaa ugcag  ugg g
               |||||||| || ||||||| ||||||| |||||  ||| a
3'             guuagucu ug ucgaaua guauuuu auguc  acu a
   acgacguacaaa        c  a       u       a     ua   g 
Get sequence
Deep sequencing
112191 reads, 271 reads per million, 155 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 74191198-74191294 [+]
sense
OTTHUMT00000314560 ; NCF1-001; intron 1
OTTHUMT00000343530 ; NCF1-015; intron 1
OTTHUMT00000343529 ; NCF1-014; intron 1
OTTHUMT00000343436 ; NCF1-007; intron 1
OTTHUMT00000314561 ; NCF1-002; intron 1
OTTHUMT00000343438 ; NCF1-009; intron 1
OTTHUMT00000314562 ; NCF1-003; exon 1
ENST00000289473 ; NCF1-001; intron 1
ENST00000438106 ; NCF1-015; intron 1
ENST00000433458 ; NCF1-014; intron 1
ENST00000449343 ; NCF1-007; intron 1
ENST00000398421 ; NCF1-002; intron 1
ENST00000455062 ; NCF1-009; intron 1
ENST00000443956 ; NCF1-003; exon 1
antisense
ENST00000380775 ; STAG3L2-202; intron 8
Database links

Mature sequence hsa-miR-590-5p

Accession MIMAT0003258
Previous IDshsa-miR-590
Sequence

16 - 

gagcuuauucauaaaagugcag

 - 37

Get sequence
Deep sequencing51503 reads, 152 experiments
Evidence experimental; Microarray [1], SAGE [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-590-3p

Accession MIMAT0004801
Sequence

56 - 

uaauuuuauguauaagcuagu

 - 76

Get sequence
Deep sequencing60488 reads, 151 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).