Stem-loop sequence hsa-mir-550a-2

AccessionMI0003601 (change log)
Previous IDshsa-mir-550-2
Symbol HGNC:MIR550A2
DescriptionHomo sapiens miR-550a-2 stem-loop
Gene family MIPF0000334; mir-550
Literature search

18 open access papers mention hsa-mir-550a-2
(113 sentences)

Stem-loop
   ugaugcuuu   g     u ca                  g c     gu 
5'          gcu gcugg g  gugccugagggaguaaga c cuguu  u
            ||| ||||| |  |||||||||||||||||| | |||||  g
3'          uga cgacc c  cacggacucccucauucu g gauag  u
   -----ucuc   g     u ua                  - u     ac 
Get sequence
Deep sequencing
8808 reads, 16.9 reads per million, 154 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 32732981-32733077 [+]
sense
ENST00000404479 ; AVL9-201; intron 10
antisense
OTTHUMT00000328640 ; AC018633.4-001; intron 7
ENST00000417811 ; DPY19L1P1-001; intron 7
Clustered miRNAs
< 10kb from hsa-mir-550a-2
hsa-mir-550b-2chr7: 32732981-32733077 [-]
hsa-mir-550a-2chr7: 32732981-32733077 [+]
Database links

Mature sequence hsa-miR-550a-5p

Accession MIMAT0004800
Previous IDshsa-miR-550;hsa-miR-550a
Sequence

22 - 

agugccugagggaguaagagccc

 - 44

Get sequence
Deep sequencing8584 reads, 140 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-550a-3p

Accession MIMAT0003257
Previous IDshsa-miR-550;hsa-miR-550*;hsa-miR-550a*
Sequence

61 - 

ugucuuacucccucaggcacau

 - 82

Get sequence
Deep sequencing13506 reads, 136 experiments
Evidence experimental; RAKE [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).