Stem-loop sequence hsa-mir-589

AccessionMI0003599 (change log)
Symbol HGNC:MIR589
DescriptionHomo sapiens miR-589 stem-loop
Gene family MIPF0000496; mir-589
Stem-loop
   ucca   ugu  cca     cc   a     -a   c  c       u   u 
5'     gcc   gc   gcagc  cug gaacc  cgu ug ucugagc ggg a
       |||   ||   |||||  ||| |||||  ||| || ||||||| ||| c
3'     cgg   cg   cgucg  gac cuugg  gua ac agacuug ucc u
   ---c   --u  -ac     ca   c     cc   a  a       -   g 
Get sequence
Deep sequencing
4757 reads, 18.2 reads per million, 66 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 5495819-5495917 [-]
sense
OTTHUMT00000324092 ; FBXL18-002; intron 4
ENST00000415009 ; FBXL18-002; intron 4
Database links

Mature sequence hsa-miR-589-5p

Accession MIMAT0004799
Previous IDshsa-miR-589
Sequence

24 - 

ugagaaccacgucugcucugag

 - 45

Get sequence
Deep sequencing3313 reads, 61 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-589-3p

Accession MIMAT0003256
Previous IDshsa-miR-589;hsa-miR-589*
Sequence

61 - 

ucagaacaaaugccgguucccaga

 - 84

Get sequence
Deep sequencing1444 reads, 60 experiments
Evidence experimental; SAGE [1]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).