Stem-loop sequence hsa-mir-588

AccessionMI0003597 (change log)
Symbol HGNC:MIR588
DescriptionHomo sapiens miR-588 stem-loop
Gene family MIPF0000681; mir-588
Literature search

5 open access papers mention hsa-mir-588
(54 sentences)

Stem-loop
   ag       a       -     caa     u       uau 
5'   cuuaggu ccaauuu ggcca   ugggu agaacac   u
     ||||||| ||||||| |||||   ||||| |||||||   c
3'   gaauccg gguuaaa ccggu   accca ucuugug   c
   --       -       a     acc     u       uua 
Get sequence
Deep sequencing
139 reads, 4.44 reads per million, 45 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 126484631-126484713 [+]
intergenic
Database links

Mature sequence hsa-miR-588

Accession MIMAT0003255
Sequence

16 - 

uuggccacaauggguuagaac

 - 36

Get sequence
Deep sequencing86 reads, 29 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).