Stem-loop sequence hsa-mir-548b

AccessionMI0003596 (change log)
Symbol HGNC:MIR548B
DescriptionHomo sapiens miR-548b stem-loop
Gene family MIPF0000317; mir-548
Literature search

47 open access papers mention hsa-mir-548b
(155 sentences)

Stem-loop
   cagacuauauau                       u      g   uuuau 
5'             uuagguuggcgcaaaaguaauug gguuuu gcc     u
               ||||||||||||||||||||||| |||||| |||      
3'             aauccaaccguguuuucguugac ccaaga cgg     u
   -------uucau                       u      a   uaacu 
Get sequence
Deep sequencing
21165 reads, 35.9 reads per million, 153 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 119069047-119069143 [-]
intergenic
Database links

Mature sequence hsa-miR-548b-5p

Accession MIMAT0004798
Sequence

25 - 

aaaaguaauugugguuuuggcc

 - 46

Get sequence
Deep sequencing9708 reads, 152 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-548b-3p

Accession MIMAT0003254
Previous IDshsa-miR-548b
Sequence

61 - 

caagaaccucaguugcuuuugu

 - 82

Get sequence
Deep sequencing11400 reads, 123 experiments
Evidence experimental; SAGE [1], cloned [2]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).