Stem-loop sequence hsa-mir-548a-1

AccessionMI0003593 (change log)
Symbol HGNC:MIR548A1
DescriptionHomo sapiens miR-548a-1 stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548a-1
(170 sentences)

Stem-loop
   ---ug    gagguauuaag                   g u     c a   a 
5'      cagg           uuggugcaaaaguaauugu a uuuug c uua a
        ||||           ||||||||||||||||||| | ||||| | |||  
3'      gucc           aaccacguuuucauuaacg u aaaac g aau a
   uuaug    ----------a                   g c     a c   g 
Get sequence
Deep sequencing
11903 reads, 21.5 reads per million, 149 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 18571784-18571880 [+]
intergenic
Database links

Mature sequence hsa-miR-548a-3p

Accession MIMAT0003251
Previous IDshsa-miR-548a
Sequence

61 - 

caaaacuggcaauuacuuuugc

 - 82

Get sequence
Deep sequencing21333 reads, 118 experiments
Evidence experimental; SAGE [1], cloned [2]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).