|
miRBase |
|
Stem-loop sequence hsa-mir-584 |
|||||
| Accession | MI0003591 | ||||
| Symbol | HGNC:MIR584 | ||||
| Description | Homo sapiens miR-584 stem-loop | ||||
| Gene family | MIPF0000533; mir-584 | ||||
| Stem-loop |
------- u uua u g a ug uaggg gaccagcca ugguu gccugggacuga g auu c ||||| ||||||||| ||||| |||||||||||| | ||| guccc cugguuggu accaa cggaccuugacu u uag u caacgaa u cgg c g a gg |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-584-5p |
|
| Accession | MIMAT0003249 |
| Previous IDs | hsa-miR-584 |
| Sequence |
16 - uuaugguuugccugggacugag - 37 |
| Deep sequencing | 9661 reads, 20 experiments |
| Evidence | experimental; Microarray [1], RT-PCR [1], SAGE [1], cloned [2-3] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence hsa-miR-584-3p |
|
| Accession | MIMAT0022708 |
| Sequence |
55 - ucaguuccaggccaaccaggcu - 76 |
| Deep sequencing | 193 reads, 11 experiments |
| Evidence | not experimental |
| Predicted targets |
|
References |
|
| 1 |
PMID:16505370
"The colorectal microRNAome"
Proc Natl Acad Sci U S A. 103:3687-3692(2006).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 3 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|