Stem-loop sequence hsa-mir-584

AccessionMI0003591 (change log)
Symbol HGNC:MIR584
DescriptionHomo sapiens miR-584 stem-loop
Gene family MIPF0000533; mir-584
Literature search

25 open access papers mention hsa-mir-584
(420 sentences)

Stem-loop
   -------     u         uua     u            g a   ug 
5'        uaggg gaccagcca   ugguu gccugggacuga g auu  c
          ||||| |||||||||   ||||| |||||||||||| | |||   
3'        guccc cugguuggu   accaa cggaccuugacu u uag  u
   caacgaa     u         cgg     c            g a   gg 
Get sequence
Deep sequencing
30856 reads, 97 reads per million, 101 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 149062313-149062409 [-]
intergenic
Database links

Mature sequence hsa-miR-584-5p

Accession MIMAT0003249
Previous IDshsa-miR-584
Sequence

16 - 

uuaugguuugccugggacugag

 - 37

Get sequence
Deep sequencing30452 reads, 98 experiments
Evidence experimental; Microarray [1], RT-PCR [1], SAGE [1], cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-584-3p

Accession MIMAT0022708
Sequence

55 - 

ucaguuccaggccaaccaggcu

 - 76

Get sequence
Deep sequencing391 reads, 34 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).