Stem-loop sequence hsa-mir-583

AccessionMI0003590 (change log)
Symbol HGNC:MIR583
DescriptionHomo sapiens miR-583 stem-loop
Gene family MIPF0000482; mir-583
Literature search

7 open access papers mention hsa-mir-583
(60 sentences)

Stem-loop
   aacucacacauua          a        u      -     
5'              accaaagagg agguccca uacugc aggg 
                |||||||||| |||||||| |||||| ||| a
3'              ugguuucucc uccagggu augacg uucu 
   -------------          a        c      a     
Get sequence
Deep sequencing
7 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 96079138-96079212 [+]
sense
OTTHUMT00000370573 ; CAST-037; intron 2
OTTHUMT00000370575 ; CAST-039; intron 2
OTTHUMT00000370574 ; CAST-038; intron 2
OTTHUMT00000370550 ; CAST-014; intron 3
OTTHUMT00000370708 ; CAST-041; intron 3
OTTHUMT00000370555 ; CAST-019; intron 7
OTTHUMT00000250197 ; CAST-002; intron 10
OTTHUMT00000370556 ; CAST-020; intron 11
OTTHUMT00000370553 ; CAST-017; intron 12
OTTHUMT00000250198 ; CAST-003; intron 13
OTTHUMT00000370543 ; CAST-007; intron 14
OTTHUMT00000370547 ; CAST-011; intron 14
OTTHUMT00000250199 ; CAST-004; intron 14
OTTHUMT00000370549 ; CAST-013; intron 14
OTTHUMT00000370552 ; CAST-016; intron 14
OTTHUMT00000370554 ; CAST-018; intron 14
OTTHUMT00000277083 ; CAST-005; intron 15
OTTHUMT00000370546 ; CAST-010; intron 15
OTTHUMT00000370548 ; CAST-012; intron 15
OTTHUMT00000370544 ; CAST-008; intron 17
ENST00000508579 ; CAST-037; intron 2
ENST00000509259 ; CAST-039; intron 2
ENST00000503828 ; CAST-038; intron 2
ENST00000510500 ; CAST-014; intron 3
ENST00000437034 ; CAST-041; intron 3
ENST00000513666 ; CAST-019; intron 7
ENST00000348386 ; CAST-002; intron 10
ENST00000504465 ; CAST-020; intron 11
ENST00000509903 ; CAST-017; intron 12
ENST00000309190 ; CAST-003; intron 13
ENST00000511097 ; CAST-007; intron 14
ENST00000395812 ; CAST-011; intron 14
ENST00000341926 ; CAST-004; intron 14
ENST00000511049 ; CAST-013; intron 14
ENST00000510156 ; CAST-016; intron 14
ENST00000511782 ; CAST-018; intron 14
ENST00000325674 ; CAST-201; intron 14
ENST00000338252 ; CAST-005; intron 15
ENST00000510756 ; CAST-010; intron 15
ENST00000508608 ; CAST-012; intron 15
ENST00000359176 ; CAST-202; intron 15
ENST00000395813 ; CAST-203; intron 16
ENST00000508830 ; CAST-008; intron 17
Database links

Mature sequence hsa-miR-583

Accession MIMAT0003248
Sequence

16 - 

caaagaggaaggucccauuac

 - 36

Get sequence
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).