Stem-loop sequence hsa-mir-582

Accession MI0003589
Symbol HGNC:MIR582
Description Homo sapiens miR-582 stem-loop
Gene family MIPF0000417; mir-582
Stem-loop 
----------auc  ug       auua                   uaaucu 
             ug  cucuuug    caguuguucaaccaguuac      a
             ||  |||||||    |||||||||||||||||||       
             ac  gggaaac    gucaacaaguuggucaaug      a
uuacaaagaugaa  gu       ccaa                   uuaauc
Get sequence
Deep sequencing
748 reads, 17 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr5: 58999432-58999529 [-]
sense
OTTHUMT00000367940 ; PDE4D-001; intron 1
OTTHUMT00000368103 ; PDE4D-012; intron 1
OTTHUMT00000368104 ; PDE4D-013; intron 1
OTTHUMT00000368093 ; PDE4D-002; intron 1
OTTHUMT00000368102 ; PDE4D-011; intron 1
OTTHUMT00000368797 ; PDE4D-022; intron 1
OTTHUMT00000367940 ; PDE4D-001; intron 1
OTTHUMT00000368103 ; PDE4D-012; intron 1
OTTHUMT00000368104 ; PDE4D-013; intron 1
OTTHUMT00000368093 ; PDE4D-002; intron 1
OTTHUMT00000368102 ; PDE4D-011; intron 1
OTTHUMT00000368797 ; PDE4D-022; intron 1
OTTHUMT00000367940 ; PDE4D-001; intron 1
OTTHUMT00000368103 ; PDE4D-012; intron 1
OTTHUMT00000368104 ; PDE4D-013; intron 1
OTTHUMT00000368093 ; PDE4D-002; intron 1
OTTHUMT00000368102 ; PDE4D-011; intron 1
OTTHUMT00000368797 ; PDE4D-022; intron 1
OTTHUMT00000368800 ; PDE4D-025; intron 2
OTTHUMT00000368800 ; PDE4D-025; intron 2
OTTHUMT00000368800 ; PDE4D-025; intron 2
OTTHUMT00000368094 ; PDE4D-003; intron 3
OTTHUMT00000368094 ; PDE4D-003; intron 3
OTTHUMT00000368094 ; PDE4D-003; intron 3
ENST00000340635 ; PDE4D-001; intron 1
ENST00000507116 ; PDE4D-012; intron 1
ENST00000309641 ; PDE4D-013; intron 1
ENST00000405053 ; PDE4D-002; intron 1
ENST00000502575 ; PDE4D-011; intron 1
ENST00000512069 ; PDE4D-022; intron 1
ENST00000340635 ; PDE4D-001; intron 1
ENST00000507116 ; PDE4D-012; intron 1
ENST00000309641 ; PDE4D-013; intron 1
ENST00000405053 ; PDE4D-002; intron 1
ENST00000502575 ; PDE4D-011; intron 1
ENST00000512069 ; PDE4D-022; intron 1
ENST00000340635 ; PDE4D-001; intron 1
ENST00000507116 ; PDE4D-012; intron 1
ENST00000309641 ; PDE4D-013; intron 1
ENST00000405053 ; PDE4D-002; intron 1
ENST00000502575 ; PDE4D-011; intron 1
ENST00000512069 ; PDE4D-022; intron 1
ENST00000514231 ; PDE4D-025; intron 2
ENST00000546160 ; PDE4D-202; intron 2
ENST00000514231 ; PDE4D-025; intron 2
ENST00000546160 ; PDE4D-202; intron 2
ENST00000514231 ; PDE4D-025; intron 2
ENST00000546160 ; PDE4D-201; intron 2
ENST00000502484 ; PDE4D-003; intron 3
ENST00000502484 ; PDE4D-003; intron 3
ENST00000502484 ; PDE4D-003; intron 3
Database links

Mature sequence hsa-miR-582-5p

Accession MIMAT0003247
Previous IDs hsa-miR-582
Sequence

16 -  

uuacaguuguucaaccaguuacu

 - 38

Get sequence
Deep sequencing 265 reads, 11 experiments
Evidence experimental; Microarray [1], RT-PCR [1], SAGE [1], cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-582-3p

Accession MIMAT0004797
Sequence

53 -  

uaacugguugaacaacugaacc

 - 74

Get sequence
Deep sequencing 481 reads, 13 experiments
Evidence experimental; cloned [2-3]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).