Stem-loop sequence hsa-mir-582

AccessionMI0003589 (change log)
Symbol HGNC:MIR582
DescriptionHomo sapiens miR-582 stem-loop
Gene family MIPF0000417; mir-582
Literature search

36 open access papers mention hsa-mir-582
(203 sentences)

Stem-loop
   ----------auc  ug       auua                   uaaucu 
5'              ug  cucuuug    caguuguucaaccaguuac      a
                ||  |||||||    |||||||||||||||||||       
3'              ac  gggaaac    gucaacaaguuggucaaug      a
   uuacaaagaugaa  gu       ccaa                   uuaauc 
Get sequence
Deep sequencing
65718 reads, 152 reads per million, 154 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 59703606-59703703 [-]
sense
OTTHUMT00000368094 ; PDE4D-003; intron 1
OTTHUMT00000368095 ; PDE4D-004; intron 1
OTTHUMT00000368099 ; PDE4D-008; intron 1
OTTHUMT00000368097 ; PDE4D-006; intron 1
OTTHUMT00000368098 ; PDE4D-007; intron 1
OTTHUMT00000368100 ; PDE4D-009; intron 1
OTTHUMT00000368101 ; PDE4D-010; intron 1
ENST00000502484 ; PDE4D-003; intron 1
ENST00000509355 ; PDE4D-004; intron 1
ENST00000506024 ; PDE4D-008; intron 1
ENST00000506510 ; PDE4D-006; intron 1
ENST00000511382 ; PDE4D-007; intron 1
ENST00000505507 ; PDE4D-009; intron 1
ENST00000515835 ; PDE4D-010; intron 1
Database links

Mature sequence hsa-miR-582-5p

Accession MIMAT0003247
Previous IDshsa-miR-582
Sequence

16 - 

uuacaguuguucaaccaguuacu

 - 38

Get sequence
Deep sequencing49970 reads, 152 experiments
Evidence experimental; Microarray [1], RT-PCR [1], SAGE [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-582-3p

Accession MIMAT0004797
Sequence

53 - 

uaacugguugaacaacugaacc

 - 74

Get sequence
Deep sequencing15745 reads, 147 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).