Stem-loop sequence hsa-mir-579

AccessionMI0003586 (change log)
Symbol HGNC:MIR579
DescriptionHomo sapiens miR-579 stem-loop
Gene family MIPF0000317; mir-548
Literature search

16 open access papers mention hsa-mir-579
(53 sentences)

Stem-loop
   cauauuag   a                                cg     aa 
5'         guu augcaaaaguaaucgcgguuugugccagauga  auuug  u
           ||| ||||||||||||||||||||||||||||||||  |||||   
3'         caa uacguuuuuauuagcgccaaauaugguuuacu  uaaau  u
   --------   c                                --     aa 
Get sequence
Deep sequencing
6680 reads, 4.29 reads per million, 140 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 32394378-32394475 [-]
sense
OTTHUMT00000366586 ; ZFR-001; intron 11
ENST00000265069 ; ZFR-001; intron 11
Database links

Mature sequence hsa-miR-579-5p

Accession MIMAT0026616
Sequence

25 - 

ucgcgguuugugccagaugacg

 - 46

Get sequence
Deep sequencing3239 reads, 113 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence hsa-miR-579-3p

Accession MIMAT0003244
Sequence

62 - 

uucauuugguauaaaccgcgauu

 - 84

Get sequence
Deep sequencing1220 reads, 104 experiments
Evidence experimental; SAGE [1], cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).