Stem-loop sequence hsa-mir-579

Accession MI0003586
Symbol HGNC:MIR579
Description Homo sapiens miR-579 stem-loop
Gene family MIPF0000317; mir-548
Stem-loop 
cauauuag   a                                cg     aa 
        guu augcaaaaguaaucgcgguuugugccagauga  auuug  u
        ||| ||||||||||||||||||||||||||||||||  |||||   
        caa uacguuuuuauuagcgccaaauaugguuuacu  uaaau  u
--------   c                                --     aa
Get sequence
Deep sequencing
69 reads, 14 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr5: 32394484-32394581 [-]
sense
OTTHUMT00000366586 ; ZFR-001; intron 11
OTTHUMT00000366586 ; ZFR-001; intron 11
OTTHUMT00000366586 ; ZFR-001; intron 11
ENST00000265069 ; ZFR-001; intron 11
ENST00000382126 ; ZFR-201; intron 11
ENST00000265069 ; ZFR-001; intron 11
ENST00000382126 ; ZFR-201; intron 11
ENST00000265069 ; ZFR-001; intron 11
Database links

Mature sequence hsa-miR-579

Accession MIMAT0003244
Sequence

62 -  

uucauuugguauaaaccgcgauu

 - 84

Get sequence
Deep sequencing 20 reads, 6 experiments
Evidence experimental; SAGE [1], cloned [2]
Validated targets
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).