Stem-loop sequence hsa-mir-578

AccessionMI0003585 (change log)
Symbol HGNC:MIR578
DescriptionHomo sapiens miR-578 stem-loop
Gene family MIPF0000477; mir-578
Literature search

2 open access papers mention hsa-mir-578
(5 sentences)

Stem-loop
   agauaaauc                   cg  ca          ccu      
5'          uauagacaaaauacaaucc  ga  acaagaagcu   auagc 
            |||||||||||||||||||  ||  ||||||||||   |||| u
3'          auauuuguuuuauguuagg  cu  uguucuucga   ugucc 
   ------uau                   au  cg          ---      
Get sequence
Deep sequencing
56 reads, 0 reads per million, 32 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 165386242-165386337 [+]
intergenic
Database links

Mature sequence hsa-miR-578

Accession MIMAT0003243
Sequence

61 - 

cuucuugugcucuaggauugu

 - 81

Get sequence
Deep sequencing29 reads, 21 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).