Stem-loop sequence hsa-mir-576

Accession MI0003583
Symbol HGNC:MIR576
Description Homo sapiens miR-576 stem-loop
Gene family MIPF0000493; mir-576
Stem-loop 
--------ua     c  c              c            g   ua 
          caauc aa gaggauucuaauuu uccacgucuuug uaa  a
          ||||| || |||||||||||||| |||||||||||| |||   
          guuag uu cuccuaagguuaaa agguguagaaac guu  g
accaauauug     c  a              a            g   ug
Get sequence
Deep sequencing
373 reads, 27 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr4: 110409854-110409951 [+]
sense
OTTHUMT00000364694 ; SEC24B-002; intron 3
OTTHUMT00000364694 ; SEC24B-002; intron 3
OTTHUMT00000364694 ; SEC24B-002; intron 3
OTTHUMT00000364693 ; SEC24B-001; intron 4
OTTHUMT00000364693 ; SEC24B-001; intron 4
OTTHUMT00000364693 ; SEC24B-001; intron 4
OTTHUMT00000364695 ; SEC24B-003; intron 5
OTTHUMT00000364695 ; SEC24B-003; intron 5
OTTHUMT00000364695 ; SEC24B-003; intron 5
ENST00000399100 ; SEC24B-002; intron 3
ENST00000399100 ; SEC24B-002; intron 3
ENST00000399100 ; SEC24B-002; intron 3
ENST00000265175 ; SEC24B-001; intron 4
ENST00000265175 ; SEC24B-001; intron 4
ENST00000265175 ; SEC24B-001; intron 4
ENST00000504968 ; SEC24B-003; intron 5
ENST00000504968 ; SEC24B-003; intron 5
ENST00000504968 ; SEC24B-003; intron 5
Database links

Mature sequence hsa-miR-576-5p

Accession MIMAT0003241
Previous IDs hsa-miR-576
Sequence

16 -  

auucuaauuucuccacgucuuu

 - 37

Get sequence
Deep sequencing 217 reads, 23 experiments
Evidence experimental; SAGE [1], cloned [2]
Predicted targets

Mature sequence hsa-miR-576-3p

Accession MIMAT0004796
Sequence

55 -  

aagauguggaaaaauuggaauc

 - 76

Get sequence
Deep sequencing 155 reads, 13 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).