Stem-loop sequence hsa-mir-574

Accession MI0003581
Symbol HGNC:MIR574
Description Homo sapiens miR-574 stem-loop
Gene family MIPF0000419; mir-574
Stem-loop 
gggaccug g      c         a u                 ug  gc 
        c ugggug gggcgugug g gugugugugugagugug  uc  u
        | |||||| ||||||||| | |||||||||||||||||  ||   
        g acucac cccgcacac c cacacacguacucgcac  gg  c
-------- g      a         - -                 cu  gc
Get sequence
Deep sequencing
4682 reads, 46 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr4: 38869653-38869748 [+]
sense
OTTHUMT00000360580 ; FAM114A1-004; intron 1
OTTHUMT00000360578 ; FAM114A1-002; intron 1
OTTHUMT00000250436 ; FAM114A1-001; intron 1
OTTHUMT00000360580 ; FAM114A1-004; intron 1
OTTHUMT00000360578 ; FAM114A1-002; intron 1
OTTHUMT00000250436 ; FAM114A1-001; intron 1
OTTHUMT00000360580 ; FAM114A1-004; intron 1
OTTHUMT00000360578 ; FAM114A1-002; intron 1
OTTHUMT00000250436 ; FAM114A1-001; intron 1
ENST00000510213 ; FAM114A1-004; intron 1
ENST00000515037 ; FAM114A1-002; intron 1
ENST00000358869 ; FAM114A1-001; intron 1
ENST00000510213 ; FAM114A1-004; intron 1
ENST00000515037 ; FAM114A1-002; intron 1
ENST00000358869 ; FAM114A1-001; intron 1
ENST00000510213 ; FAM114A1-004; intron 1
ENST00000515037 ; FAM114A1-002; intron 1
ENST00000358869 ; FAM114A1-001; intron 1
Database links

Mature sequence hsa-miR-574-5p

Accession MIMAT0004795
Sequence

25 -  

ugagugugugugugugagugugu

 - 47

Get sequence
Deep sequencing 1699 reads, 34 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-574-3p

Accession MIMAT0003239
Previous IDs hsa-miR-574
Sequence

61 -  

cacgcucaugcacacacccaca

 - 82

Get sequence
Deep sequencing 2980 reads, 24 experiments
Evidence experimental; Microarray [1], RT-PCR [1], SAGE [1], cloned [2-3]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).