Stem-loop sequence hsa-mir-573

AccessionMI0003580 (change log)
Symbol HGNC:MIR573
DescriptionHomo sapiens miR-573 stem-loop
Gene family MIPF0000561; mir-573
Literature search

3 open access papers mention hsa-mir-573
(3 sentences)

Stem-loop
   -uuu   -gg    u      --      gu      -g      au u  u 
5'     agc   uuuc cccuga  agugau  guaacu  aucagg  c ac c
       |||   |||| ||||||  ||||||  ||||||  ||||||  | ||  
3'     uug   ggag gggacu  ucgcug  uauuga  ugguuu  g ug a
   guuu   aga    u      gu      --      aa      cu c  u 
Get sequence
Deep sequencing
431 reads, 0 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 24520192-24520290 [-]
sense
OTTHUMT00000360152 ; DHX15-010; intron 2
ENST00000510645 ; DHX15-010; intron 2
Database links

Mature sequence hsa-miR-573

Accession MIMAT0003238
Sequence

16 - 

cugaagugauguguaacugaucag

 - 39

Get sequence
Deep sequencing428 reads, 37 experiments
Evidence experimental; SAGE [1]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).