Stem-loop sequence hsa-mir-572

AccessionMI0003579
Symbol HGNC:MIR572
DescriptionHomo sapiens miR-572 stem-loop
Gene family MIPF0000537; mir-572
Stem-loop
   gucgaggccguggcccggaaguggucg          -       -a     c 
5'                            gggccgcugc gggcgga  gggcg c
                              |||||||||| |||||||  |||||  
3'                            cccgguggcg cucgccu  uucgu u
   -----------agggcgcccggaccga          g       gc     g 
Get sequence
Deep sequencing
34 reads, 289 reads per million, 27 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr4: 11368827-11368921 [+]
intergenic
Database links

Mature sequence hsa-miR-572

Accession MIMAT0003237
Sequence

61 - 

guccgcucggcgguggccca

 - 80

Get sequence
Evidence experimental; Microarray [1], SAGE [1]
Validated targets
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).