Stem-loop sequence hsa-mir-570

Accession MI0003577
Symbol HGNC:MIR570
Description Homo sapiens miR-570 stem-loop
Gene family MIPF0000317; mir-548
Stem-loop 
cuagauaag         g                 a      c c      
         uuauuaggu ggugcaaagguaauugc guuuuu c auuau 
         ||||||||| ||||||||||||||||| |||||| | |||| u
         gguagucca ccacguuuccauuaacg caaaag g uaauu 
------uga         a                 a      c u
Get sequence
Deep sequencing
reads, experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr3: 195426272-195426368 [+]
sense
OTTHUMT00000341945 ; AC069513.3-012; intron 1
OTTHUMT00000341944 ; AC069513.3-011; intron 1
OTTHUMT00000341939 ; AC069513.3-006; intron 1
OTTHUMT00000341945 ; AC069513.3-012; intron 1
OTTHUMT00000341944 ; AC069513.3-011; intron 1
OTTHUMT00000341939 ; AC069513.3-006; intron 1
OTTHUMT00000341945 ; AC069513.3-012; intron 1
OTTHUMT00000341944 ; AC069513.3-011; intron 1
OTTHUMT00000341939 ; AC069513.3-006; intron 1
OTTHUMT00000341946 ; AC069513.3-013; intron 2
OTTHUMT00000341935 ; AC069513.3-002; intron 2
OTTHUMT00000341946 ; AC069513.3-013; intron 2
OTTHUMT00000341935 ; AC069513.3-002; intron 2
OTTHUMT00000341946 ; AC069513.3-013; intron 2
OTTHUMT00000341935 ; AC069513.3-002; intron 2
ENST00000431767 ; AC069513.3-012; intron 1
ENST00000451228 ; AC069513.3-011; intron 1
ENST00000438608 ; AC069513.3-006; intron 1
ENST00000431767 ; AC069513.3-012; intron 1
ENST00000451228 ; AC069513.3-011; intron 1
ENST00000438608 ; AC069513.3-006; intron 1
ENST00000431767 ; AC069513.3-012; intron 1
ENST00000451228 ; AC069513.3-011; intron 1
ENST00000438608 ; AC069513.3-006; intron 1
ENST00000420851 ; AC069513.3-013; intron 2
ENST00000451982 ; AC069513.3-002; intron 2
ENST00000420851 ; AC069513.3-013; intron 2
ENST00000451982 ; AC069513.3-002; intron 2
ENST00000420851 ; AC069513.3-013; intron 2
ENST00000451982 ; AC069513.3-002; intron 2
ENST00000381954 ; MUC20-202; intron 3
ENST00000381954 ; MUC20-202; intron 3
ENST00000381954 ; MUC20-202; intron 3
Database links

Mature sequence hsa-miR-570-5p

Accession MIMAT0022707
Sequence

25 -  

aaagguaauugcaguuuuuccc

 - 46

Get sequence
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-570-3p

Accession MIMAT0003235
Previous IDs hsa-miR-570
Sequence

60 -  

cgaaaacagcaauuaccuuugc

 - 81

Get sequence
Evidence experimental; SAGE [1], cloned [2]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).