Stem-loop sequence hsa-mir-570

AccessionMI0003577
Symbol HGNC:MIR570
DescriptionHomo sapiens miR-570 stem-loop
Gene family MIPF0000317; mir-548
Stem-loop
   cuagauaag         g                 a      c c      
5'          uuauuaggu ggugcaaagguaauugc guuuuu c auuau 
            ||||||||| ||||||||||||||||| |||||| | |||| u
3'          gguagucca ccacguuuccauuaacg caaaag g uaauu 
   ------uga         a                 a      c u      
Get sequence
Deep sequencing
154 reads, 61.4 reads per million, 41 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr3: 195699401-195699497 [+]
antisense
OTTHUMT00000341371 ; SDHAP1-006; intron 2
OTTHUMT00000341367 ; SDHAP1-002; intron 10
OTTHUMT00000341366 ; SDHAP1-001; intron 10
ENST00000457601 ; SDHAP1-006; intron 2
ENST00000427841 ; SDHAP1-002; intron 10
ENST00000440850 ; SDHAP1-001; intron 10
ENST00000354937 ; SDHAP1-201; intron 11
Database links

Mature sequence hsa-miR-570-5p

Accession MIMAT0022707
Sequence

25 - 

aaagguaauugcaguuuuuccc

 - 46

Get sequence
Deep sequencing26 reads, 13 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-570-3p

Accession MIMAT0003235
Previous IDshsa-miR-570
Sequence

60 - 

cgaaaacagcaauuaccuuugc

 - 81

Get sequence
Deep sequencing45 reads, 23 experiments
Evidence experimental; SAGE [1], cloned [2]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).