Stem-loop sequence hsa-mir-551b

AccessionMI0003575
Symbol HGNC:MIR551B
DescriptionHomo sapiens miR-551b stem-loop
Gene family MIPF0000360; mir-551
Stem-loop
   agaugugc    c     ca          cg     - -aga    gug 
5'         ucuc uggcc  ugaaaucaag  ugggu g    ccug   c
           |||| |||||  ||||||||||  ||||| |    ||||    
3'         agag gucgg  acuuugguuc  accca c    gggc   a
   ----aaua    u     ag          au     g ggaa    aag 
Get sequence
Deep sequencing
404 reads, 237 reads per million, 38 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr3: 168551854-168551949 [+]
intergenic
Database links

Mature sequence hsa-miR-551b-5p

Accession MIMAT0004794
Previous IDshsa-miR-551b*
Sequence

22 - 

gaaaucaagcgugggugagacc

 - 43

Get sequence
Deep sequencing32 reads, 9 experiments
Evidence experimental; cloned [2]
Predicted targets

Mature sequence hsa-miR-551b-3p

Accession MIMAT0003233
Previous IDshsa-miR-551b
Sequence

61 - 

gcgacccauacuugguuucag

 - 81

Get sequence
Deep sequencing126 reads, 20 experiments
Evidence experimental; Microarray [1], RT-PCR [1], SAGE [1], cloned [2]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).