Stem-loop sequence hsa-mir-567

AccessionMI0003573 (change log)
Symbol HGNC:MIR567
DescriptionHomo sapiens miR-567 stem-loop
Gene family MIPF0000555; mir-567
Literature search

4 open access papers mention hsa-mir-567
(72 sentences)

Stem-loop
   ------------ggauucuua   gaca              g      ---  u 
5'                      uag    guauguucuuccag acagaa   ca u
                        |||    |||||||||||||| ||||||   || c
3'                      auc    cguacaagaagguc uguuuu   gu u
   ucguuauugaaaaaaaaaaaa   aaaa              a      auc  u 
Get sequence
Deep sequencing
3832 reads, 70.7 reads per million, 99 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 112112801-112112898 [+]
intergenic
Database links

Mature sequence hsa-miR-567

Accession MIMAT0003231
Sequence

16 - 

aguauguucuuccaggacagaac

 - 38

Get sequence
Deep sequencing2120 reads, 9 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).