Dead miRNA entry

miRNA accession:
MI0003572
miRNA ID:
hsa-mir-566
Comment:
The sequence annotated as miR-566 maps many times to the human genome, and the pattern of reads from deep sequencing datasets does not support the miRNA annotation. The sequence is therefore removed from the database.

Previous miRNA entry

Stem-loop sequence hsa-mir-566

AccessionMI0003572 (change log)
Symbol HGNC:MIR566
DescriptionHomo sapiens miR-566 stem-loop
Gene family MIPF0000576; mir-566
Stem-loop
   ----------------gcuagg  u   gg      --c    ga     a  a u 
5'                       cg ggu  cgggcg   cugu  uccca cu c c
                         || |||  ||||||   ||||  ||||| || |  
3'                       gc cca  guucgc   gacg  ggggu gg g a
   cgagugacguuggaagcggagg  -   -a      uaa    ac     c  a g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-566

Accession MIMAT0003230
Sequence

16 - 

gggcgccugugaucccaac

 - 34

Get sequence
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).