Stem-loop sequence hsa-mir-562

AccessionMI0003568 (change log)
Symbol HGNC:MIR562
DescriptionHomo sapiens miR-562 stem-loop
Gene family MIPF0000512; mir-562
Literature search

5 open access papers mention hsa-mir-562
(69 sentences)

Stem-loop
   agugaa       -----   -  u     -   u       ua   u   u u 
5'       auugcua     ggu ca auggu cag cuacuuu  gag aau g g
         |||||||     ||| || ||||| ||| |||||||  ||| ||| | a
3'       uaacggu     uca gu uacca guc gaugaaa  cuu uug c a
   ------       guccc   c  u     u   -       --   u   u a 
Get sequence
Deep sequencing
23 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 232172653-232172747 [+]
sense
OTTHUMT00000332954 ; ARMC9-004; intron 1
OTTHUMT00000333107 ; ARMC9-014; intron 8
OTTHUMT00000332953 ; ARMC9-003; intron 18
OTTHUMT00000256966 ; ARMC9-001; intron 19
ENST00000486787 ; ARMC9-004; intron 1
ENST00000428662 ; ARMC9-014; intron 8
ENST00000483477 ; ARMC9-003; intron 18
ENST00000349938 ; ARMC9-001; intron 19
Database links

Mature sequence hsa-miR-562

Accession MIMAT0003226
Sequence

61 - 

aaaguagcuguaccauuugc

 - 80

Get sequence
Deep sequencing7 reads, 5 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).