Stem-loop sequence hsa-mir-561

AccessionMI0003567 (change log)
Symbol HGNC:MIR561
DescriptionHomo sapiens miR-561 stem-loop
Gene family MIPF0000623; mir-561
Literature search

5 open access papers mention hsa-mir-561
(26 sentences)

Stem-loop
   cuucauccaccag            a                     agag 
5'              uccuccaggaac ucaaggaucuuaaacuuugcc    c
                |||||||||||| |||||||||||||||||||||    u
3'              aggggguccuug aguuccuagaauuugaaacgg    a
   --------uacca            a                     aaac 
Get sequence
Deep sequencing
2384 reads, 32.6 reads per million, 132 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 188297492-188297588 [+]
sense
OTTHUMT00000334574 ; AC007319.1-001; intron 2
OTTHUMT00000334575 ; AC007319.1-002; intron 2
ENST00000453517 ; AC007319.1-001; intron 2
ENST00000412276 ; AC007319.1-002; intron 2
antisense
OTTHUMT00000255883 ; CALCRL-001; intron 1
OTTHUMT00000334648 ; CALCRL-002; intron 1
OTTHUMT00000334650 ; CALCRL-004; intron 1
OTTHUMT00000334652 ; CALCRL-006; intron 1
OTTHUMT00000334651 ; CALCRL-005; intron 1
OTTHUMT00000334655 ; CALCRL-009; intron 1
OTTHUMT00000334649 ; CALCRL-003; intron 1
OTTHUMT00000334654 ; CALCRL-008; intron 2
OTTHUMT00000334653 ; CALCRL-007; intron 3
ENST00000392370 ; CALCRL-001; intron 1
ENST00000409998 ; CALCRL-002; intron 1
ENST00000410068 ; CALCRL-004; intron 1
ENST00000447403 ; CALCRL-006; intron 1
ENST00000410102 ; CALCRL-005; intron 1
ENST00000485973 ; CALCRL-009; intron 1
ENST00000479784 ; CALCRL-003; intron 1
ENST00000474212 ; CALCRL-008; intron 2
ENST00000461244 ; CALCRL-007; intron 3
Database links

Mature sequence hsa-miR-561-5p

Accession MIMAT0022706
Sequence

26 - 

aucaaggaucuuaaacuuugcc

 - 47

Get sequence
Deep sequencing1914 reads, 120 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-561-3p

Accession MIMAT0003225
Previous IDshsa-miR-561
Sequence

61 - 

caaaguuuaagauccuugaagu

 - 82

Get sequence
Deep sequencing450 reads, 84 experiments
Evidence experimental; SAGE [1], cloned [2]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).