Stem-loop sequence hsa-mir-559

AccessionMI0003565 (change log)
Symbol HGNC:MIR559
DescriptionHomo sapiens miR-559 stem-loop
Gene family MIPF0000656; mir-559
Literature search

5 open access papers mention hsa-mir-559
(13 sentences)

Stem-loop
   -----                                     ------   u 
5'      gcuccaguaacaucuuaaaguaaauaugcaccaaaau      uac u
        |||||||||||||||||||||||||||||||||||||      ||| u
3'      cgaggucauuguaggauuucauuuauacgugguuuug      aug u
   acccu                                     acauaa   g 
Get sequence
Deep sequencing
164 reads, 9.52 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 47377675-47377770 [+]
antisense
OTTHUMT00000329714 ; C2orf61-002; intron 1
OTTHUMT00000250790 ; C2orf61-001; intron 3
OTTHUMT00000471753 ; RP11-761B3.1-001; intron 4
ENST00000449846 ; C2orf61-002; intron 1
ENST00000294947 ; C2orf61-001; intron 3
ENST00000445927 ; C2orf61-201; intron 3
ENST00000422269 ; RP11-761B3.1-001; intron 4
Database links

Mature sequence hsa-miR-559

Accession MIMAT0003223
Sequence

16 - 

uaaaguaaauaugcaccaaaa

 - 36

Get sequence
Deep sequencing23 reads, 17 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).