Stem-loop sequence hsa-mir-556

Accession

MI0003562 (change log)

Symbol

HGNC:MIR556

Description

Homo sapiens miR-556 stem-loop

Gene family

MIPF0000475; mir-556

Literature search

5 open access papers mention hsa-mir-556
(5 sentences)

Stem-loop

   -------ga                     c  u          cuucau 
5'          uaguaauaagaaagaugagcu au guaauaugag      u
            ||||||||||||||||||||| || ||||||||||       
3'          aucauuauuuuuucuacucga ua cauuauacuu      u
   acaacuucc                     u  c          uacaua 

Deep sequencing

2723 reads, 3.28 reads per million, 122 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr1: 162342546-162342640 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000331964 ; NOS1AP-005; intron 1

  OTTHUMT00000382765 ; RP11-565P22.6-001; intron 2

  OTTHUMT00000382766 ; C1orf226-003; intron 2

  ENST00000367932 ; NOS1AP-005; intron 1

  ENST00000431696 ; RP11-565P22.6-001; intron 2

  ENST00000420220 ; C1orf226-003; intron 2

Database links

• EntrezGene:MIR556
• HGNC:MIR556
• RNAcentral:URS00006C3A3C_9606
• miRBase Tracker:MI0003562

Mature sequence hsa-miR-556-5p

• Accession: MIMAT0003220
• Previous IDs: hsa-miR-556
• Sequence: 16 - gaugagcucauuguaauaugag - 37
• Deep sequencing: 1840 reads, 100 experiments
• Evidence: experimental; SAGE [1], cloned [2]
• Database links:
  • RNAcentral:URS000033CC69_9606
• Predicted targets:
  • TargetMiner:hsa-miR-556-5p
  • TargetScanVert:hsa-miR-556-5p
  • miRDB:hsa-miR-556-5p
  • microrna.org:hsa-miR-556-5p

Mature sequence hsa-miR-556-3p

• Accession: MIMAT0004793
• Sequence: 55 - auauuaccauuagcucaucuuu - 76
• Deep sequencing: 873 reads, 88 experiments
• Evidence: experimental; cloned [2]
• Database links:
  • RNAcentral:URS00001D6605_9606
• Predicted targets:
  • TargetMiner:hsa-miR-556-3p
  • TargetScanVert:hsa-miR-556-3p
  • miRDB:hsa-miR-556-3p
  • microrna.org:hsa-miR-556-3p

References

1. PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).