Stem-loop sequence hsa-mir-556

AccessionMI0003562 (change log)
Symbol HGNC:MIR556
DescriptionHomo sapiens miR-556 stem-loop
Gene family MIPF0000475; mir-556
Literature search

5 open access papers mention hsa-mir-556
(5 sentences)

Stem-loop
   -------ga                     c  u          cuucau 
5'          uaguaauaagaaagaugagcu au guaauaugag      u
            ||||||||||||||||||||| || ||||||||||       
3'          aucauuauuuuuucuacucga ua cauuauacuu      u
   acaacuucc                     u  c          uacaua 
Get sequence
Deep sequencing
2723 reads, 3.28 reads per million, 122 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 162342546-162342640 [+]
sense
OTTHUMT00000331964 ; NOS1AP-005; intron 1
OTTHUMT00000382765 ; RP11-565P22.6-001; intron 2
OTTHUMT00000382766 ; C1orf226-003; intron 2
ENST00000367932 ; NOS1AP-005; intron 1
ENST00000431696 ; RP11-565P22.6-001; intron 2
ENST00000420220 ; C1orf226-003; intron 2
Database links

Mature sequence hsa-miR-556-5p

Accession MIMAT0003220
Previous IDshsa-miR-556
Sequence

16 - 

gaugagcucauuguaauaugag

 - 37

Get sequence
Deep sequencing1840 reads, 100 experiments
Evidence experimental; SAGE [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-556-3p

Accession MIMAT0004793
Sequence

55 - 

auauuaccauuagcucaucuuu

 - 76

Get sequence
Deep sequencing873 reads, 88 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).