|
miRBase |
|
Stem-loop sequence hsa-mir-556 |
|||||
| Accession | MI0003562 | ||||
| Symbol | HGNC:MIR556 | ||||
| Description | Homo sapiens miR-556 stem-loop | ||||
| Gene family | MIPF0000475; mir-556 | ||||
| Stem-loop |
-------ga c u cuucau uaguaauaagaaagaugagcu au guaauaugag u ||||||||||||||||||||| || |||||||||| aucauuauuuuuucuacucga ua cauuauacuu u acaacuucc u c uacaua |
||||
| Deep sequencing |
| ||||
| Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-556-5p |
|
| Accession | MIMAT0003220 |
| Previous IDs | hsa-miR-556 |
| Sequence |
16 - gaugagcucauuguaauaugag - 37 |
| Deep sequencing | 13 reads, 7 experiments |
| Evidence | experimental; SAGE [1], cloned [2] |
| Predicted targets |
|
Mature sequence hsa-miR-556-3p |
|
| Accession | MIMAT0004793 |
| Sequence |
55 - auauuaccauuagcucaucuuu - 76 |
| Deep sequencing | 21 reads, 7 experiments |
| Evidence | experimental; cloned [2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16505370
"The colorectal microRNAome"
Proc Natl Acad Sci U S A. 103:3687-3692(2006).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|