![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-556 |
|||||
Accession | MI0003562 (change log) | ||||
Symbol | HGNC:MIR556 | ||||
Description | Homo sapiens miR-556 stem-loop | ||||
Gene family | MIPF0000475; mir-556 | ||||
Literature search |
5 open access papers mention hsa-mir-556 | ||||
Stem-loop |
-------ga c u cuucau 5' uaguaauaagaaagaugagcu au guaauaugag u ||||||||||||||||||||| || |||||||||| 3' aucauuauuuuuucuacucga ua cauuauacuu u acaacuucc u c uacaua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-556-5p |
|
Accession | MIMAT0003220 |
Previous IDs | hsa-miR-556 |
Sequence |
16 - gaugagcucauuguaauaugag - 37 |
Deep sequencing | 1840 reads, 100 experiments |
Evidence | experimental; SAGE [1], cloned [2] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-556-3p |
|
Accession | MIMAT0004793 |
Sequence |
55 - auauuaccauuagcucaucuuu - 76 |
Deep sequencing | 873 reads, 88 experiments |
Evidence | experimental; cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16505370
"The colorectal microRNAome"
Proc Natl Acad Sci U S A. 103:3687-3692(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|