Stem-loop sequence hsa-mir-556

Accession MI0003562
Symbol HGNC:MIR556
Description Homo sapiens miR-556 stem-loop
Gene family MIPF0000475; mir-556
Stem-loop 
-------ga                     c  u          cuucau 
         uaguaauaagaaagaugagcu au guaauaugag      u
         ||||||||||||||||||||| || ||||||||||       
         aucauuauuuuuucuacucga ua cauuauacuu      u
acaacuucc                     u  c          uacaua
Get sequence
Deep sequencing
34 reads, 14 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 162312336-162312430 [+]
sense
OTTHUMT00000382762 ; NOS1AP-008; intron 5
OTTHUMT00000060555 ; NOS1AP-001; intron 5
OTTHUMT00000382763 ; NOS1AP-009; intron 5
OTTHUMT00000382762 ; NOS1AP-008; intron 5
OTTHUMT00000060555 ; NOS1AP-001; intron 5
OTTHUMT00000382763 ; NOS1AP-009; intron 5
OTTHUMT00000382762 ; NOS1AP-008; intron 5
OTTHUMT00000060555 ; NOS1AP-001; intron 5
OTTHUMT00000382763 ; NOS1AP-009; intron 5
ENST00000530878 ; NOS1AP-008; intron 5
ENST00000361897 ; NOS1AP-001; intron 5
ENST00000430120 ; NOS1AP-009; intron 5
ENST00000530878 ; NOS1AP-008; intron 5
ENST00000361897 ; NOS1AP-001; intron 5
ENST00000430120 ; NOS1AP-009; intron 5
ENST00000530878 ; NOS1AP-008; intron 5
ENST00000361897 ; NOS1AP-001; intron 5
ENST00000430120 ; NOS1AP-009; intron 5
Database links

Mature sequence hsa-miR-556-5p

Accession MIMAT0003220
Previous IDs hsa-miR-556
Sequence

16 -  

gaugagcucauuguaauaugag

 - 37

Get sequence
Deep sequencing 13 reads, 7 experiments
Evidence experimental; SAGE [1], cloned [2]
Predicted targets

Mature sequence hsa-miR-556-3p

Accession MIMAT0004793
Sequence

55 -  

auauuaccauuagcucaucuuu

 - 76

Get sequence
Deep sequencing 21 reads, 7 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).