Stem-loop sequence hsa-mir-92b

AccessionMI0003560 (change log)
Symbol HGNC:MIR92B
DescriptionHomo sapiens miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

201 open access papers mention hsa-mir-92b
(617 sentences)

Stem-loop
   c     cc   c    g     ga       c            uuuuu 
5'  gggcc  ggg gggc ggagg  cgggacg ggugcaguguug     u
    |||||  ||| |||| |||||  ||||||| ||||||||||||     c
3'  cccgg  ccc cccg ccucc  gcccugc ucacguuauaac     c
   -     -c   -    g     -g       -            cgccc 
Get sequence
Deep sequencing
1772141 reads, 4.6e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 155195177-155195272 [+]
antisense
OTTHUMT00000087218 ; GBAP1-001; intron 1
ENST00000368374 ; GBAP1-001; intron 1
ENST00000313929 ; GBAP1-201; intron 1
Database links

Mature sequence hsa-miR-92b-5p

Accession MIMAT0004792
Previous IDshsa-miR-92b*
Sequence

20 - 

agggacgggacgcggugcagug

 - 41

Get sequence
Deep sequencing12181 reads, 147 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-92b-3p

Accession MIMAT0003218
Previous IDshsa-miR-92b
Sequence

61 - 

uauugcacucgucccggccucc

 - 82

Get sequence
Deep sequencing1759766 reads, 159 experiments
Evidence experimental; Microarray [1], RT-PCR [1], SAGE [1], cloned [2-3]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).