Stem-loop sequence hsa-mir-553

AccessionMI0003558 (change log)
Symbol HGNC:MIR553
DescriptionHomo sapiens miR-553 stem-loop
Gene family MIPF0000487; mir-553
Stem-loop
   cuucaau    u                   g  uu 
5'        uuua uuuaaaacggugagauuuu uu  g
          |||| ||||||||||||||||||| ||   
3'        gagu agauuuugucgcucuaaaa ag  u
   ------g    c                   g  uc 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 100281241-100281308 [+]
intergenic
Database links

Mature sequence hsa-miR-553

Accession MIMAT0003216
Sequence

16 - 

aaaacggugagauuuuguuuu

 - 36

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).