Stem-loop sequence hsa-mir-552

AccessionMI0003557 (change log)
Symbol HGNC:MIR552
DescriptionHomo sapiens miR-552 stem-loop
Gene family MIPF0000501; mir-552
Literature search

7 open access papers mention hsa-mir-552
(10 sentences)

Stem-loop
   aaccauucaa                      uu ug        uu aa 
5'           auauaccacaguuuguuuaacc  u  ccuguugg  g  g
             ||||||||||||||||||||||  |  ||||||||  |  a
3'           uauauggugucaaacagauugg  a  ggacaacu  c  u
   -------aca                      uc gu        uu cg 
Get sequence
Deep sequencing
152 reads, 0 reads per million, 48 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 34669599-34669694 [-]
antisense
OTTHUMT00000011463 ; C1orf94-001; intron 4
OTTHUMT00000036845 ; C1orf94-002; intron 4
ENST00000373374 ; C1orf94-001; intron 4
ENST00000488417 ; C1orf94-002; intron 4
Database links

Mature sequence hsa-miR-552-5p

Accession MIMAT0026615
Sequence

25 - 

guuuaaccuuuugccuguugg

 - 45

Get sequence
Deep sequencing64 reads, 25 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-552-3p

Accession MIMAT0003215
Sequence

61 - 

aacaggugacugguuagacaa

 - 81

Get sequence
Deep sequencing84 reads, 32 experiments
Evidence experimental; SAGE [1], Illumina [2]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).