Stem-loop sequence hsa-mir-551a

AccessionMI0003556 (change log)
Symbol HGNC:MIR551A
DescriptionHomo sapiens miR-551a stem-loop
Gene family MIPF0000360; mir-551
Literature search

13 open access papers mention hsa-mir-551a
(14 sentences)

Stem-loop
   ggggacug  -   ug            c         ggg   -  ucug 
5'         cc ggg  acccuggaaauc agagugggu   gcc ag    a
           || |||  |||||||||||| |||||||||   ||| ||    c
3'         gg ccc  ugggaccuuugg ucucaccca   cgg uc    c
   -----aaa  u   gu            u         --g   a  uuug 
Get sequence
Deep sequencing
799 reads, 7.23 reads per million, 83 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 3560695-3560790 [-]
sense
OTTHUMT00000001471 ; WRAP73-002; intron 3
OTTHUMT00000001470 ; WRAP73-001; intron 3
OTTHUMT00000001474 ; WRAP73-005; intron 3
OTTHUMT00000001473 ; WRAP73-004; intron 3
OTTHUMT00000001475 ; WRAP73-006; intron 3
ENST00000378322 ; WRAP73-002; intron 3
ENST00000270708 ; WRAP73-001; intron 3
ENST00000424367 ; WRAP73-005; intron 3
ENST00000465916 ; WRAP73-004; intron 3
ENST00000419924 ; WRAP73-006; intron 3
Database links

Mature sequence hsa-miR-551a

Accession MIMAT0003214
Sequence

61 - 

gcgacccacucuugguuucca

 - 81

Get sequence
Deep sequencing786 reads, 81 experiments
Evidence experimental; SAGE [1]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).