Stem-loop sequence rno-mir-20b

Accession MI0003554
Description Rattus norvegicus miR-20b stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
gu       -           g     g   -  uuu 
  agugcca aagugcucaua ugcag uag gu   g
  ||||||| ||||||||||| ||||| ||| ||    
  ucauggu uucacgagugu acguc auc ca   c
-c       c           g     -   u  cgu 
Get sequence
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (RGSC3.4) Overlapping transcripts
X: 139741071-139741142 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-20b
rno-mir-17-2 X: 139741444-139741521 [-]
rno-mir-20b X: 139741071-139741142 [-]
rno-mir-19b-2 X: 139740932-139741027 [-]
rno-mir-92a-2 X: 139740802-139740893 [-]
rno-mir-363 X: 139740651-139740737 [-]
Database links

Mature sequence rno-miR-20b-5p

Accession MIMAT0003211
Previous IDs rno-miR-20b
Sequence

8 - 

caaagugcucauagugcagguag

 - 30

Get sequence
Evidence experimental; SOLiD [3]
Predicted targets

Mature sequence rno-miR-20b-3p

Accession MIMAT0003212
Previous IDs rno-miR-20b*
Sequence

46 - 

acugcagugugagcacuucugg

 - 67

Get sequence
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).