Stem-loop sequence rno-mir-363

Accession MI0003553
Description Rattus norvegicus miR-363 stem-loop
Gene family MIPF0000138; mir-363
Stem-loop 
      u   au         ca  a         ga  ag g 
uuuugc guu  cggguggau  cg ugcaauuuu  uu  a u
|||||| |||  |||||||||  || |||||||||  ||  |  
aggacg caa  gucuaccua  gc acguuaaag  ag  u a
      c   au         ug  -         ag  gg a
Get sequence
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (RGSC3.4) Overlapping transcripts
X: 139740651-139740737 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-363
rno-mir-17-2 X: 139741444-139741521 [-]
rno-mir-20b X: 139741071-139741142 [-]
rno-mir-19b-2 X: 139740932-139741027 [-]
rno-mir-92a-2 X: 139740802-139740893 [-]
rno-mir-363 X: 139740651-139740737 [-]
Database links
  • ENTREZGENE: 100314169;Mir363

Mature sequence rno-miR-363-5p

Accession MIMAT0003209
Previous IDs rno-miR-363-5p;rno-miR-363*
Sequence

13 -  

cggguggaucacgaugcaauuu

 - 34

Get sequence
Evidence experimental; SOLiD [3]
Predicted targets

Mature sequence rno-miR-363-3p

Accession MIMAT0003210
Previous IDs rno-miR-363-3p;rno-miR-363
Sequence

56 -  

aauugcacgguauccaucugu

 - 76

Get sequence
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).