Stem-loop sequence rno-mir-369

AccessionMI0003551 (change log)
DescriptionRattus norvegicus miR-369 stem-loop
Gene family MIPF0000018; mir-154
Literature search

8 open access papers mention rno-mir-369
(12 sentences)

Stem-loop
         u  ag               ua      cuu  c 
5' gguacu ga  ggagaucgaccgugu  uauucg   ag u
   |||||| ||  |||||||||||||||  ||||||   ||  
3' cuauga cu  uuucuaguugguaca  auaagc   uc g
         -  cu               ua      --u  a 
Get sequence
Deep sequencing
146030 reads, 81.8 reads per million, 423 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133893693-133893771 [+]
antisense
ENSRNOT00000053620 ; Mir3578-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-369
rno-mir-3592chr6: 133884161-133884276 [-]
rno-mir-382chr6: 133884178-133884257 [+]
rno-mir-134chr6: 133884547-133884619 [+]
rno-mir-668chr6: 133885141-133885208 [+]
rno-mir-485chr6: 133885299-133885377 [+]
rno-mir-154chr6: 133888586-133888669 [+]
rno-mir-496chr6: 133889283-133889361 [+]
rno-mir-377chr6: 133890690-133890761 [+]
rno-mir-541chr6: 133892655-133892744 [+]
rno-mir-409bchr6: 133893418-133893497 [-]
rno-mir-409achr6: 133893419-133893495 [+]
rno-mir-412chr6: 133893571-133893640 [+]
rno-mir-3578chr6: 133893672-133893788 [-]
rno-mir-369chr6: 133893693-133893771 [+]
rno-mir-410chr6: 133893997-133894072 [+]
rno-mir-3072chr6: 133898795-133898905 [+]
Database links

Mature sequence rno-miR-369-5p

Accession MIMAT0003206
Sequence

14 - 

agaucgaccguguuauauucgc

 - 35

Get sequence
Deep sequencing86499 reads, 389 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-369-3p

Accession MIMAT0003207
Sequence

49 - 

aauaauacaugguugaucuuu

 - 69

Get sequence
Deep sequencing59519 reads, 386 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).