Stem-loop sequence rno-mir-485

AccessionMI0003549 (change log)
DescriptionRattus norvegicus miR-485 stem-loop
Gene family MIPF0000201; mir-485
Literature search

8 open access papers mention rno-mir-485
(45 sentences)

Stem-loop
         u         cu       -    a    auuc 
5' gauacu ggagagagg  ggccgug auga uucg    a
   |||||| |||||||||  ||||||| |||| ||||    u
3' cuguga cuucucucc  ucggcac uacu gagc    c
         u         uc       a    -    aaau 
Get sequence
Deep sequencing
64473 reads, 191 reads per million, 385 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133885299-133885377 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-485
rno-mir-381chr6: 133876615-133876675 [+]
rno-mir-487bchr6: 133877124-133877205 [+]
rno-mir-3576chr6: 133877812-133877926 [-]
rno-mir-539chr6: 133877832-133877907 [+]
rno-mir-6331chr6: 133878578-133878700 [+]
rno-mir-544chr6: 133879169-133879246 [+]
rno-mir-3592chr6: 133884161-133884276 [-]
rno-mir-382chr6: 133884178-133884257 [+]
rno-mir-134chr6: 133884547-133884619 [+]
rno-mir-668chr6: 133885141-133885208 [+]
rno-mir-485chr6: 133885299-133885377 [+]
rno-mir-154chr6: 133888586-133888669 [+]
rno-mir-496chr6: 133889283-133889361 [+]
rno-mir-377chr6: 133890690-133890761 [+]
rno-mir-541chr6: 133892655-133892744 [+]
rno-mir-409bchr6: 133893418-133893497 [-]
rno-mir-409achr6: 133893419-133893495 [+]
rno-mir-412chr6: 133893571-133893640 [+]
rno-mir-3578chr6: 133893672-133893788 [-]
rno-mir-369chr6: 133893693-133893771 [+]
rno-mir-410chr6: 133893997-133894072 [+]
Database links

Mature sequence rno-miR-485-5p

Accession MIMAT0003203
Previous IDsrno-miR-485
Sequence

12 - 

agaggcuggccgugaugaauuc

 - 33

Get sequence
Deep sequencing46510 reads, 337 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-485-3p

Accession MIMAT0017222
Previous IDsrno-miR-485*
Sequence

51 - 

cauacacggcucuccucucuuc

 - 72

Get sequence
Deep sequencing17905 reads, 342 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).