Stem-loop sequence rno-mir-382

AccessionMI0003548 (change log)
DescriptionRattus norvegicus miR-382 stem-loop
Gene family MIPF0000018; mir-154
Literature search

10 open access papers mention rno-mir-382
(153 sentences)

Stem-loop
         u       -a           ug      - uuu 
5' gguacu gaagaga  guuguucgugg  gauucg c   a
   |||||| |||||||  |||||||||||  |||||| |   c
3' ccauga cuuuuuu  caacaggcacu  cuaagc g   u
         -       ca           ua      a ugu 
Get sequence
Deep sequencing
75880 reads, 99.3 reads per million, 418 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133884178-133884257 [+]
antisense
ENSRNOT00000053748 ; Mir3592-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-382
rno-mir-381chr6: 133876615-133876675 [+]
rno-mir-487bchr6: 133877124-133877205 [+]
rno-mir-3576chr6: 133877812-133877926 [-]
rno-mir-539chr6: 133877832-133877907 [+]
rno-mir-6331chr6: 133878578-133878700 [+]
rno-mir-544chr6: 133879169-133879246 [+]
rno-mir-3592chr6: 133884161-133884276 [-]
rno-mir-382chr6: 133884178-133884257 [+]
rno-mir-134chr6: 133884547-133884619 [+]
rno-mir-668chr6: 133885141-133885208 [+]
rno-mir-485chr6: 133885299-133885377 [+]
rno-mir-154chr6: 133888586-133888669 [+]
rno-mir-496chr6: 133889283-133889361 [+]
rno-mir-377chr6: 133890690-133890761 [+]
rno-mir-541chr6: 133892655-133892744 [+]
rno-mir-409bchr6: 133893418-133893497 [-]
rno-mir-409achr6: 133893419-133893495 [+]
rno-mir-412chr6: 133893571-133893640 [+]
rno-mir-3578chr6: 133893672-133893788 [-]
rno-mir-369chr6: 133893693-133893771 [+]
rno-mir-410chr6: 133893997-133894072 [+]
Database links

Mature sequence rno-miR-382-5p

Accession MIMAT0003201
Previous IDsrno-miR-382
Sequence

13 - 

gaaguuguucgugguggauucg

 - 34

Get sequence
Deep sequencing67458 reads, 403 experiments
Evidence experimental; cloned [3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-382-3p

Accession MIMAT0003202
Previous IDsrno-miR-382*
Sequence

49 - 

aaucauucacggacaacacuu

 - 69

Get sequence
Deep sequencing8421 reads, 295 experiments
Evidence experimental; cloned [2], Northern [2], SOLiD [4]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).