|
miRBase |
|
Mature sequence rno-miR-382-5p |
|
| Accession | MIMAT0003201 |
| Previous IDs | rno-miR-382 |
| Sequence |
13 - gaaguuguucgugguggauucg - 34 |
| Evidence | experimental; cloned [3], SOLiD [4] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence rno-miR-382-3p |
|
| Accession | MIMAT0003202 |
| Previous IDs | rno-miR-382* |
| Sequence |
49 - aaucauucacggacaacacuu - 69 |
| Evidence | experimental; cloned [2], Northern [2], SOLiD [4] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 2 | |
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|