|
miRBase |
|
Mature sequence rno-miR-381-5p |
|
| Accession | MIMAT0017220 |
| Previous IDs | rno-miR-381* |
| Sequence |
1 - agcgagguugcccuuuguauau - 22 |
| Evidence | experimental; SOLiD [2] |
| Predicted targets |
|
Mature sequence rno-miR-381-3p |
|
| Accession | MIMAT0003199 |
| Previous IDs | rno-miR-381 |
| Sequence |
42 - uauacaagggcaagcucu - 59 |
| Evidence | experimental; SOLiD [2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|