|
miRBase |
|
Mature sequence rno-miR-376b-5p |
|
| Accession | MIMAT0003195 |
| Previous IDs | rno-miR-376b* |
| Sequence |
16 - guggauauuccuucuaugguua - 37 |
| Evidence | experimental; cloned [2-3], SOLiD [4] |
| Predicted targets |
|
Mature sequence rno-miR-376b-3p |
|
| Accession | MIMAT0003196 |
| Previous IDs | rno-miR-376b |
| Sequence |
53 - aucauagaggaacauccacuu - 73 |
| Evidence | experimental; cloned [2], SOLiD [4] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 3 |
PMID:17805466
"Cloning and identification of novel microRNAs from rat hippocampus"
Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
|
| 4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|