Stem-loop sequence rno-mir-376c

AccessionMI0003543 (change log)
DescriptionRattus norvegicus miR-376c stem-loop
Gene family MIPF0000091; mir-368
Literature search

8 open access papers mention rno-mir-376c
(50 sentences)

Stem-loop
   u  gu   u    g     ua     u         uggua 
5'  ug  auu aaaa gugga  uuccu cuauguuua     u
    ||  ||| |||| |||||  ||||| |||||||||     u
3'  ac  uga uuuu cacuu  aagga gauacaaau     u
   a  ug   c    g     ua     -         uagua 
Get sequence
Deep sequencing
42384 reads, 21.2 reads per million, 396 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133872439-133872522 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-376c
rno-mir-494chr6: 133864370-133864452 [+]
rno-mir-679chr6: 133864564-133864700 [+]
rno-mir-1193chr6: 133864698-133864817 [+]
rno-mir-666chr6: 133866523-133866621 [+]
rno-mir-543chr6: 133866660-133866739 [+]
rno-mir-495chr6: 133868288-133868367 [+]
rno-mir-667chr6: 133869570-133869661 [+]
rno-mir-376cchr6: 133872439-133872522 [+]
rno-mir-376bchr6: 133873095-133873180 [+]
rno-mir-3595chr6: 133873587-133873706 [-]
rno-mir-376achr6: 133873605-133873686 [+]
rno-mir-300chr6: 133874152-133874230 [+]
rno-mir-381chr6: 133876615-133876675 [+]
rno-mir-487bchr6: 133877124-133877205 [+]
rno-mir-3576chr6: 133877812-133877926 [-]
rno-mir-539chr6: 133877832-133877907 [+]
rno-mir-6331chr6: 133878578-133878700 [+]
rno-mir-544chr6: 133879169-133879246 [+]
Database links

Mature sequence rno-miR-376c-5p

Accession MIMAT0017219
Previous IDsrno-miR-376c*
Sequence

15 - 

guggauauuccuucuauguuu

 - 35

Get sequence
Deep sequencing30412 reads, 350 experiments
Evidence experimental; SOLiD [3]
Predicted targets

Mature sequence rno-miR-376c-3p

Accession MIMAT0003194
Previous IDsrno-miR-376c
Sequence

52 - 

aacauagaggaaauuucacgu

 - 72

Get sequence
Deep sequencing11972 reads, 343 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).