|
miRBase |
|
Stem-loop sequence mmu-mir-291b |
|||||
| Accession | MI0003539 | ||||
| Symbol | MGI:Mir291b | ||||
| Description | Mus musculus miR-291b stem-loop | ||||
| Gene family | MIPF0000068; mir-290 | ||||
| Stem-loop |
u u u g - c cu gg acauacag g cga caaagugga gc c u ccgc c |||||||| | ||| ||||||||| || | | |||| uguguguc c guu guuuuaccu cg g a ggcg u u u u a u a ag gu |
||||
| Deep sequencing |
| ||||
| Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence mmu-miR-291b-5p |
|
| Accession | MIMAT0003189 |
| Sequence |
13 - gaucaaaguggaggcccucucc - 34 |
| Deep sequencing | 36928 reads, 30 experiments |
| Evidence | experimental; cloned [1-2], Solexa [3-4] |
| Predicted targets |
|
Mature sequence mmu-miR-291b-3p |
|
| Accession | MIMAT0003190 |
| Sequence |
48 - aaagugcauccauuuuguuugu - 69 |
| Deep sequencing | 4039 reads, 14 experiments |
| Evidence | experimental; cloned [1-2], Solexa [3-4] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|