Stem-loop sequence mmu-mir-291b

AccessionMI0003539 (change log)
Symbol MGI:Mir291b
DescriptionMus musculus miR-291b stem-loop
Gene family MIPF0000068; mir-290
Literature search

21 open access papers mention mmu-mir-291b
(140 sentences)

Stem-loop
           u u   u         g  - c cu    gg 
5' acauacag g cga caaagugga gc c u  ccgc  c
   |||||||| | ||| ||||||||| || | |  ||||   
3' uguguguc c guu guuuuaccu cg g a  ggcg  u
           u u   u         a  u a ag    gu 
Get sequence
Deep sequencing
46480 reads, 502 reads per million, 43 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 3219482-3219560 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-291b
mmu-mir-290achr7: 3218626-3218708 [+]
mmu-mir-290bchr7: 3218638-3218695 [-]
mmu-mir-291achr7: 3218919-3219000 [+]
mmu-mir-292achr7: 3219189-3219270 [+]
mmu-mir-292bchr7: 3219198-3219259 [-]
mmu-mir-291bchr7: 3219482-3219560 [+]
mmu-mir-293chr7: 3220343-3220422 [+]
mmu-mir-294chr7: 3220641-3220724 [+]
mmu-mir-295chr7: 3220773-3220841 [+]
Database links

Mature sequence mmu-miR-291b-5p

Accession MIMAT0003189
Sequence

13 - 

gaucaaaguggaggcccucucc

 - 34

Get sequence
Deep sequencing40411 reads, 38 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-291b-3p

Accession MIMAT0003190
Sequence

48 - 

aaagugcauccauuuuguuugu

 - 69

Get sequence
Deep sequencing6066 reads, 25 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).