Stem-loop sequence mmu-mir-450a-2

AccessionMI0003537 (change log)
Previous IDsmmu-mir-450-2
Symbol MGI:Mir450-2
DescriptionMus musculus miR-450a-2 stem-loop
Gene family MIPF0000128; mir-450
Literature search

8 open access papers mention mmu-mir-450a-2
(83 sentences)

Stem-loop
          uuu     u              uac 
5' gaacuau   ugcga guguuccuaauaug   u
   |||||||   ||||| ||||||||||||||   a
3' cuuggua   acguu cguagggguuauau   u
          cuu     u              gag 
Get sequence
Deep sequencing
31412 reads, 104 reads per million, 102 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 53048299-53048367 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-450a-2
mmu-mir-322chrX: 53054255-53054349 [-]
mmu-mir-503chrX: 53053984-53054054 [-]
mmu-mir-351chrX: 53053255-53053353 [-]
mmu-mir-542chrX: 53049403-53049487 [-]
mmu-mir-450a-2chrX: 53048299-53048367 [-]
mmu-mir-450a-1chrX: 53048154-53048244 [-]
mmu-mir-450bchrX: 53047997-53048078 [-]
Database links

Mature sequence mmu-miR-450a-5p

Accession MIMAT0001546
Previous IDsmmu-miR-450;mmu-miR-450a-5p;mmu-miR-450a
Sequence

8 - 

uuuugcgauguguuccuaauau

 - 29

Get sequence
Deep sequencing60635 reads, 102 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-450a-2-3p

Accession MIMAT0004789
Previous IDsmmu-miR-450a-3p;mmu-miR-450a-2*
Sequence

43 - 

auuggggaugcuuugcauucau

 - 64

Get sequence
Deep sequencing1089 reads, 54 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).