Stem-loop sequence mmu-mir-20b

AccessionMI0003536 (change log)
Symbol MGI:Mir20b
DescriptionMus musculus miR-20b stem-loop
Gene family MIPF0000001; mir-17
Literature search

87 open access papers mention mmu-mir-20b
(160 sentences)

Stem-loop
   c    u     -ca           g     g   uuuuu 
5'  cuag agugc   aagugcucaua ugcag uag     a
    |||| |||||   ||||||||||| ||||| |||     u
3'  gguc ucaug   uucacgagugu acguc auc     a
   -    c     auc           g     -   ucacc 
Get sequence
Deep sequencing
27487 reads, 69.7 reads per million, 99 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 52742113-52742192 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-20b
mmu-mir-106achrX: 52742503-52742567 [-]
mmu-mir-18bchrX: 52742331-52742413 [-]
mmu-mir-20bchrX: 52742113-52742192 [-]
mmu-mir-19b-2chrX: 52741983-52742066 [-]
mmu-mir-92a-2chrX: 52741838-52741928 [-]
mmu-mir-363chrX: 52741693-52741767 [-]
Database links

Mature sequence mmu-miR-20b-5p

Accession MIMAT0003187
Previous IDsmmu-miR-20b
Sequence

12 - 

caaagugcucauagugcagguag

 - 34

Get sequence
Deep sequencing26855 reads, 99 experiments
Evidence experimental; cloned [1,3-4], MPSS [2], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-20b-3p

Accession MIMAT0004788
Previous IDsmmu-miR-20b*
Sequence

50 - 

acugcagugugagcacuucuag

 - 71

Get sequence
Deep sequencing631 reads, 58 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).