Stem-loop sequence mmu-mir-369

AccessionMI0003535 (change log)
Symbol MGI:Mir369
DescriptionMus musculus miR-369 stem-loop
Gene family MIPF0000018; mir-154
Literature search

25 open access papers mention mmu-mir-369
(107 sentences)

Stem-loop
         u  ag               ua      cuu g 
5' gguacu ga  ggagaucgaccgugu  uauucg   g c
   |||||| ||  |||||||||||||||  ||||||   | u
3' cuauga cu  uuucuaguugguaca  auaagc   c g
         -  cu               ua      -uu a 
Get sequence
Deep sequencing
97901 reads, 335 reads per million, 91 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109743418-109743496 [+]
sense
OTTMUST00000113366 ; Mirg-004; intron 4
OTTMUST00000113368 ; Mirg-005; intron 5
OTTMUST00000114051 ; Mirg-010; intron 9
ENSMUST00000182268 ; Mirg-004; intron 4
ENSMUST00000183116 ; Mirg-005; intron 5
ENSMUST00000182185 ; Mirg-010; intron 9
Clustered miRNAs
< 10kb from mmu-mir-369
mmu-mir-382chr12: 109733771-109733846 [+]
mmu-mir-134chr12: 109734139-109734209 [+]
mmu-mir-668chr12: 109734732-109734797 [+]
mmu-mir-485chr12: 109734902-109734974 [+]
mmu-mir-453chr12: 109735619-109735700 [+]
mmu-mir-154chr12: 109738433-109738498 [+]
mmu-mir-496achr12: 109739119-109739197 [+]
mmu-mir-377chr12: 109740510-109740577 [+]
mmu-mir-541chr12: 109742409-109742498 [+]
mmu-mir-409chr12: 109743158-109743236 [+]
mmu-mir-412chr12: 109743289-109743368 [+]
mmu-mir-369chr12: 109743418-109743496 [+]
mmu-mir-410chr12: 109743715-109743795 [+]
mmu-mir-3072chr12: 109747878-109747960 [+]
Database links

Mature sequence mmu-miR-369-5p

Accession MIMAT0003185
Sequence

14 - 

agaucgaccguguuauauucgc

 - 35

Get sequence
Deep sequencing19081 reads, 77 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-369-3p

Accession MIMAT0003186
Sequence

49 - 

aauaauacaugguugaucuuu

 - 69

Get sequence
Deep sequencing78814 reads, 88 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).