Stem-loop sequence mmu-mir-487b

AccessionMI0003534 (change log)
Symbol MGI:Mir487b
DescriptionMus musculus miR-487b stem-loop
Gene family MIPF0000018; mir-154
Literature search

17 open access papers mention mmu-mir-487b
(59 sentences)

Stem-loop
   u      ug        uuau      c uc    - uuc 
5'  gguacu  gagagugg    cccugu c  uucg c   a
    ||||||  ||||||||    |||||| |  |||| |   c
3'  cuauga  uuuucacc    gggaca g  aagc g   u
   a      cu        uacu      u cu    c uac 
Get sequence
Deep sequencing
22519 reads, 125 reads per million, 75 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109727333-109727414 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-487b
mmu-mir-495chr12: 109718754-109718816 [+]
mmu-mir-667chr12: 109720006-109720097 [+]
mmu-mir-376cchr12: 109722718-109722803 [+]
mmu-mir-654chr12: 109723218-109723301 [+]
mmu-mir-376bchr12: 109723458-109723539 [+]
mmu-mir-376achr12: 109723781-109723848 [+]
mmu-mir-300chr12: 109724313-109724391 [+]
mmu-mir-381chr12: 109726822-109726896 [+]
mmu-mir-487bchr12: 109727333-109727414 [+]
mmu-mir-539chr12: 109728129-109728202 [+]
mmu-mir-544chr12: 109729325-109729402 [+]
mmu-mir-382chr12: 109733771-109733846 [+]
mmu-mir-134chr12: 109734139-109734209 [+]
mmu-mir-668chr12: 109734732-109734797 [+]
mmu-mir-485chr12: 109734902-109734974 [+]
mmu-mir-453chr12: 109735619-109735700 [+]
Database links

Mature sequence mmu-miR-487b-5p

Accession MIMAT0017216
Previous IDsmmu-miR-487b*
Sequence

15 - 

ugguuaucccuguccucuucg

 - 35

Get sequence
Deep sequencing75 reads, 25 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

Mature sequence mmu-miR-487b-3p

Accession MIMAT0003184
Previous IDsmmu-miR-487b
Sequence

50 - 

aaucguacagggucauccacuu

 - 71

Get sequence
Deep sequencing22417 reads, 73 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).