|
miRBase |
|
Mature sequence mmu-miR-376c-5p |
|
| Accession | MIMAT0005295 |
| Previous IDs | mmu-miR-376c* |
| Sequence |
16 - guggauauuccuucuauguuua - 37 |
| Deep sequencing | 18503 reads, 45 experiments |
| Evidence | experimental; cloned [1], Solexa [4-5] |
| Predicted targets |
|
Mature sequence mmu-miR-376c-3p |
|
| Accession | MIMAT0003183 |
| Previous IDs | mmu-miR-376c |
| Sequence |
53 - aacauagaggaaauuucacgu - 73 |
| Deep sequencing | 5539 reads, 51 experiments |
| Evidence | experimental; cloned [1], Solexa [4-5] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 2 |
PMID:17322061
"Redirection of silencing targets by adenosine-to-inosine editing of miRNAs"
Science. 315:1137-1140(2007).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|