|
miRBase |
|
Mature sequence mmu-miR-494-5p |
|
| Accession | MIMAT0017215 |
| Previous IDs | mmu-miR-494* |
| Sequence |
17 - agguuguccguguugucuucuc - 38 |
| Deep sequencing | 70 reads, 19 experiments |
| Evidence | experimental; Solexa [5] |
| Predicted targets |
|
Mature sequence mmu-miR-494-3p |
|
| Accession | MIMAT0003182 |
| Previous IDs | mmu-miR-494 |
| Sequence |
50 - ugaaacauacacgggaaaccuc - 71 |
| Deep sequencing | 16474 reads, 64 experiments |
| Evidence | experimental; cloned [1,3], MPSS [2], Solexa [4-5] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 2 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|