Stem-loop sequence mmu-mir-367

AccessionMI0003531 (change log)
Symbol MGI:Mir367
DescriptionMus musculus miR-367 stem-loop
Gene family MIPF0000162; mir-367
Literature search

24 open access papers mention mmu-mir-367
(87 sentences)

Stem-loop
      -                ca     c    uugaa 
5' agg ccgucacuguugcuaa  ugcaa ucug     u
   ||| ||||||||||||||||  ||||| ||||      
3' ucc gguagugguaacgauu  acguu aggu     a
      a                uc     a    uaaag 
Get sequence
Deep sequencing
867 reads, 0 reads per million, 22 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 127545733-127545807 [+]
antisense
ENSMUST00000029588 ; Larp7-201; intron 8
Clustered miRNAs
< 10kb from mmu-mir-367
mmu-mir-302bchr3: 127545228-127545301 [+]
mmu-mir-302cchr3: 127545363-127545430 [+]
mmu-mir-302achr3: 127545496-127545564 [+]
mmu-mir-302dchr3: 127545624-127545689 [+]
mmu-mir-367chr3: 127545733-127545807 [+]
Database links

Mature sequence mmu-miR-367-5p

Accession MIMAT0017214
Previous IDsmmu-miR-367*
Sequence

9 - 

acuguugcuaacaugcaacuc

 - 29

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; Illumina [4]
Predicted targets

Mature sequence mmu-miR-367-3p

Accession MIMAT0003181
Previous IDsmmu-miR-367
Sequence

47 - 

aauugcacuuuagcaaugguga

 - 68

Get sequence
Deep sequencing858 reads, 17 experiments
Evidence experimental; cloned [1,3], MPSS [2], Illumina [4]
Database links
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).