Stem-loop sequence hsa-mir-487b

AccessionMI0003530 (change log)
Symbol HGNC:MIR487B
DescriptionHomo sapiens miR-487b stem-loop
Gene family MIPF0000018; mir-154
Literature search

31 open access papers mention hsa-mir-487b
(50 sentences)

Stem-loop
   u       ug        uuau      c u     uuuug 
5'  ugguacu  gagagugg    cccugu c guucg     c
    |||||||  ||||||||    |||||| | |||||      
3'  acuauga  uuuucacc    gggaca g uaagc     u
   a       cu        uacu      u c     uguac 
Get sequence
Deep sequencing
19112 reads, 23.7 reads per million, 118 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101046455-101046538 [+]
antisense
OTTHUMT00000414335 ; BEGAIN-006; intron 1
ENST00000554140 ; BEGAIN-006; intron 1
Clustered miRNAs
< 10kb from hsa-mir-487b
hsa-mir-376cchr14: 101039690-101039755 [+]
hsa-mir-376a-2chr14: 101040069-101040148 [+]
hsa-mir-654chr14: 101040219-101040299 [+]
hsa-mir-376bchr14: 101040436-101040535 [+]
hsa-mir-376a-1chr14: 101040782-101040849 [+]
hsa-mir-300chr14: 101041363-101041445 [+]
hsa-mir-1185-1chr14: 101042977-101043062 [+]
hsa-mir-1185-2chr14: 101044198-101044283 [+]
hsa-mir-381chr14: 101045920-101045994 [+]
hsa-mir-487bchr14: 101046455-101046538 [+]
hsa-mir-539chr14: 101047321-101047398 [+]
hsa-mir-889chr14: 101047901-101047979 [+]
hsa-mir-544achr14: 101048658-101048748 [+]
hsa-mir-655chr14: 101049550-101049646 [+]
hsa-mir-487achr14: 101052446-101052525 [+]
hsa-mir-382chr14: 101054306-101054381 [+]
hsa-mir-134chr14: 101054687-101054759 [+]
hsa-mir-668chr14: 101055258-101055323 [+]
hsa-mir-485chr14: 101055419-101055491 [+]
hsa-mir-323bchr14: 101056219-101056300 [+]
Database links

Mature sequence hsa-miR-487b-5p

Accession MIMAT0026614
Sequence

15 - 

gugguuaucccuguccuguucg

 - 36

Get sequence
Deep sequencing150 reads, 37 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence hsa-miR-487b-3p

Accession MIMAT0003180
Sequence

51 - 

aaucguacagggucauccacuu

 - 72

Get sequence
Deep sequencing18954 reads, 117 experiments
Evidence experimental; cloned [1-2], Illumina [3]
Database links
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).