Stem-loop sequence hsa-mir-376a-2

AccessionMI0003529 (change log)
Symbol HGNC:MIR376A2
DescriptionHomo sapiens miR-376a-2 stem-loop
Gene family MIPF0000091; mir-368
Literature search

79 open access papers mention hsa-mir-376a-2
(390 sentences)

Stem-loop
         u    g  a         u         --   g 
5' gguauu aaaa gu gauuuuccu cuaugguua  cgu u
   |||||| |||| || ||||||||| |||||||||  ||| u
3' cuauga uuuu ca cuaaaagga gauacuaau  gua u
         c    g  c         -         ug   g 
Get sequence
Deep sequencing
20222 reads, 120 reads per million, 132 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature miR-376a products have been shown to be modified by A to I edits [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101040069-101040148 [+]
antisense
OTTHUMT00000414335 ; BEGAIN-006; intron 1
ENST00000554140 ; BEGAIN-006; intron 1
Clustered miRNAs
< 10kb from hsa-mir-376a-2
hsa-mir-543chr14: 101031987-101032064 [+]
hsa-mir-495chr14: 101033755-101033836 [+]
hsa-mir-376cchr14: 101039690-101039755 [+]
hsa-mir-376a-2chr14: 101040069-101040148 [+]
hsa-mir-654chr14: 101040219-101040299 [+]
hsa-mir-376bchr14: 101040436-101040535 [+]
hsa-mir-376a-1chr14: 101040782-101040849 [+]
hsa-mir-300chr14: 101041363-101041445 [+]
hsa-mir-1185-1chr14: 101042977-101043062 [+]
hsa-mir-1185-2chr14: 101044198-101044283 [+]
hsa-mir-381chr14: 101045920-101045994 [+]
hsa-mir-487bchr14: 101046455-101046538 [+]
hsa-mir-539chr14: 101047321-101047398 [+]
hsa-mir-889chr14: 101047901-101047979 [+]
hsa-mir-544achr14: 101048658-101048748 [+]
hsa-mir-655chr14: 101049550-101049646 [+]
Database links

Mature sequence hsa-miR-376a-2-5p

Accession MIMAT0022928
Sequence

12 - 

gguagauuuuccuucuauggu

 - 32

Get sequence
Deep sequencing753 reads, 96 experiments
Evidence experimental; SOLiD [4]
Database links
Predicted targets

Mature sequence hsa-miR-376a-3p

Accession MIMAT0000729
Previous IDshsa-miR-376a
Sequence

50 - 

aucauagaggaaaauccacgu

 - 70

Get sequence
Deep sequencing38783 reads, 132 experiments
Evidence experimental; cloned [1,3], SOLiD [4]
Database links
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:17322061 "Redirection of silencing targets by adenosine-to-inosine editing of miRNAs" Kawahara Y, Zinshteyn B, Sethupathy P, Iizasa H, Hatzigeorgiou AG, Nishikura K Science. 315:1137-1140(2007).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).