|
miRBase |
|
Mature sequence hsa-miR-376a-2-5p |
|
| Accession | MIMAT0022928 |
| Sequence |
12 - gguagauuuuccuucuauggu - 32 |
| Deep sequencing | 5 reads, 3 experiments |
| Evidence | experimental; SOLiD [4] |
Mature sequence hsa-miR-376a-3p |
|
| Accession | MIMAT0000729 |
| Previous IDs | hsa-miR-376a |
| Sequence |
50 - aucauagaggaaaauccacgu - 70 |
| Deep sequencing | 527 reads, 20 experiments |
| Evidence | experimental; cloned [1,3] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:15891114
"Clustering and conservation patterns of human microRNAs"
Nucleic Acids Res. 33:2697-2706(2005).
|
| 2 |
PMID:17322061
"Redirection of silencing targets by adenosine-to-inosine editing of miRNAs"
Science. 315:1137-1140(2007).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 | |